Prev. | 

RIKEN DNA Bank Human Resource - C9orf78

Gene ID NCBI Gene 51759 |  KEGG hsa:51759
Gene Symbol C9orf78
Protein Name chromosome 9 open reading frame 78
Synonyms CSU2|HCA59|HSPC220|bA409K20.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081710 IRAL004E14 pOTB7 BC007664 NM_016482 Full/var
HGY092803 IRAL032A03 pDNR-LIB BC017570 NM_016482 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161660 ARi04C12 pGCAP10 NM_016520.2  
GAGAGGCGCGGCGGCTGTACAACTCGGCCGTTGTCACCATGCCGGTCGTCCGGAAGATTT
HKR389326 RBd73F06 pGCAP10 NM_016520.2  
GGCAGAGGCGCGGCGGCTGTACAACTCGGCCGTTGTCACCATGCCGGTCGTCCGGAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl