Prev. | 

RIKEN DNA Bank Human Resource - LUC7L3

Gene ID NCBI Gene 51747 |  KEGG hsa:51747
Gene Symbol LUC7L3
Protein Name LUC7 like 3 pre-mRNA splicing factor
Synonyms CRA|CREAP-1|CROP|LUC7A|OA48-18|hLuc7A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037273 IRAK093D01 pCMV-SPORT6 BC047043 NM_016424 Partial/var
HGX047951 IRAK119O15 pCMV-SPORT6 BC056409 NM_016424 Partial/var
HGX053841 IRAK134K01 pCMV-SPORT6 BC061896 NM_016424 Partial
HGY086194 IRAL015I02 pOTB7 BC002925 NM_016424

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022219 W01A055J03 pENTR-TOPO flj0038k14 AK023672 NM_016424  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051234 ARe28B10 pKA1U5 NM_016424.3  
GGTCTTGTCGGCTCCTGTGTGTAGGAGGGATTTCGGCCTGAGAGCGGGCCGAGGAGATTG
HKR366145 RBd15G01 pGCAP10 NM_016424.3  
GCATTTTGTCTTGTCGGCTCCTGTGTGTAGGAGGGATTTCGGCCTGAGAGCGGGCCGAGG
HKR452949 RBdS132G05 pGCAP10 NM_016424.3  
GAGGGATTTCGGCCTGAGAGCGGGCCGAGGAGATTGGCGACGGTGTCGCCCGTGTTTTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl