Prev. |  KEGG KO K20775 > 

RIKEN DNA Bank Human Resource - UIMC1

Gene ID NCBI Gene 51720 |  KEGG hsa:51720
Gene Symbol UIMC1
Protein Name ubiquitin interaction motif containing 1
Synonyms RAP80|X2HRIP110
Ortholog resource in our bank

  UIMC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027941 IRAK069O05 pCMV-SPORT6 BC032561 NM_016290 Full/var
HGY087431 IRAL018J15 pOTB7 BC006078 NM_016290 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260155 ARiS150G11 pGCAP10 NM_016290.3  
TGGCTCCCAACGTGTGGCGNCTCGCGACCCCCGGCAACCCGGAGAAGGTCTACAGAGCGG
HKR326898 RBb17E02 pKA1U5 NM_016290.3  
GGCGCGCGCCCCTCCCCCTCCCCCCGCGCTCCCAACGTTGTTGGCGGCTCGCGACCCCCG
HKR379280 RBd48D08 pGCAP10 NM_016290.3  
GCCCCGCGCTCCCAACGTGTGGCGGCTCGCGACCCCCGGCAACCCGGAGAAGGTCTACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl