Prev. | 

RIKEN DNA Bank Human Resource - SELENOT

Gene ID NCBI Gene 51714 |  KEGG hsa:51714
Gene Symbol SELENOT
Protein Name selenoprotein T
Synonyms SELT
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005881 IRAK014L17 pCMV-SPORT6 BC009556 NM_016275 Full/var
HGY012938 IRAK032F18 pBluescriptR BC026350 NM_016275 Full/var
HGX027875 IRAK069L11 pCMV-SPORT6 BC036738 NM_016275 Full/var
HGX066784 IRAK166P24 pCMV-SPORT6 BC071699 NM_016275 Full/var
HGY088473 IRAL021D01 pDNR-LIB BC009611 NM_016275 Full/var
HGY088681 IRAL021L17 pDNR-LIB BC008411 NM_016275 Full/var
HGY088782 IRAL021P22 pDNR-LIB BC006012 NM_016275 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR409069 RBdS022L05 pGCAP10 NM_016275.3  
GGCAGTCTGTCTGAGGGCGGCCGAAGTGGCTGGCTCATTTAAGATGAGGCTTCTGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl