Prev. |  KEGG KO K12627 > 

RIKEN DNA Bank Human Resource - LSM8

Gene ID NCBI Gene 51691 |  KEGG hsa:51691
Gene Symbol LSM8
Protein Name LSM8 homolog, U6 small nuclear RNA associated
Synonyms NAA38
Ortholog resource in our bank

  LSM8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY042643 IRAK106K03 pBluescript BC045532 NM_016200 Partial/var
HGX055753 IRAK139G09 pCMV-SPORT6 BC064376 NM_016200 Partial
HGY085042 IRAL012K02 pOTB7 BC002742 NM_016200 Full
HGY094310 IRAL035M22 pDNR-LIB BC022440 NM_016200 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003754 W01A009G10 pENTR-TOPO IRAL035M22 BC022440 NM_016200  
HGE003758 W01A009G14 pENTR-TOPO IRAL035M22 BC022440 NM_016200  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082430 ARf06B06 pKA1U5 NM_016200.3  
TTTCAGTTCTGCTTGCTGTCCGCACCGCTGCGTNACCNGGAACCGCCGGGCCGAACAGCA
HKR328178 RBb20H10 pKA1U5 NM_016200.3  
GGATATTTGCTGCGACCCGCAGGCGCTATCCGCTGCCGGGTTCTGGCGCGCCCTTTCAGT
HKR388474 RBd71D02 pGCAP10 NM_016200.3  
GAGGCGCTATCCGCTGCCGGGTTCTGGCGCGCCCTTTCAGTTCTGCTTGCTGTCCGCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl