Prev. |  KEGG KO K19369 > 

RIKEN DNA Bank Human Resource - HSPB11

Gene ID NCBI Gene 51668 |  KEGG hsa:51668
Gene Symbol HSPB11
Protein Name heat shock protein family B (small) member 11
Synonyms C1orf41|HSPCO34|IFT25|PP25
Ortholog resources KEGG ortholog (KEGG orthology K19369) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY031073 IRAK077L09 pBluescriptR BC045699 NM_016126 Partial
HGY086475 IRAL016D03 pDNR-LIB BC005245 NM_016126 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205500 ARiS013M12 pGCAP10 NM_016126.2  
GAAGGGAGGTTTCGAGCCCGGAAGGTCCGGCGCCCAGAGCTAACGGGAGTCCCAGGTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl