Prev. | 

RIKEN DNA Bank Human Resource - CDK5RAP1

Gene ID NCBI Gene 51654 |  KEGG hsa:51654
Gene Symbol CDK5RAP1
Protein Name CDK5 regulatory subunit associated protein 1
Synonyms C20orf34|C42|CGI-05|HSPC167
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044017 IRAK110A17 pCMV-SPORT6 BC050706 NM_016408 Full
HGY083271 IRAL008C23 pOTB7 BC001215 NM_016408 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR190407 ARi76A07 pGCAP10 NM_016082.3  
GGAACGCTCCGGCGGACCTGTGAGGGGATCCGACTTGCCGGCAGAACTTACGCTGCGGGA
HKR416327 RBdS040N15 pGCAP10 NM_016082.3  
GGGAACGGAAGTCGCTTGTGTATGAACGCAGCGGCGGACCTGTGAGGGGATCCGACTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl