Prev. |  KEGG KO K17411 > 

RIKEN DNA Bank Human Resource - MRPS33

Gene ID NCBI Gene 51650 |  KEGG hsa:51650
Gene Symbol MRPS33
Protein Name mitochondrial ribosomal protein S33
Synonyms CGI-139|MRP-S33|PTD003|S33mt
Ortholog resource in our bank

  MRPS33

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008916 IRAK022E20 pCMV-SPORT6 BC015462 NM_053035 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172155 ARi30G11 pGCAP10 NM_016071.2  
GATTGGTTAACAGTAGAAGGCTCAGTTTCTCTGCTCATCACACGGCCTTCGGCACTGTAG
HKR234857 ARiS087C09 pGCAP10 NM_016071.2  
GGTAGAATGCTCAGTTTCTCTGCTCATCACACGGCCTTCGGCACTGTAGCTTTGGGTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl