Prev. |  KEGG KO K12733 > 

RIKEN DNA Bank Human Resource - PPIL1

Gene ID NCBI Gene 51645 |  KEGG hsa:51645
Gene Symbol PPIL1
Protein Name peptidylprolyl isomerase like 1
Synonyms CGI-124|CYPL1|PPIase|hCyPX
Ortholog resource in our bank

  PPIL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083500 IRAL008M12 pOTB7 BC003048 NM_016059 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370850 RBd27C02 pGCAP10 NM_016059.3  
GATTCCGCCGCCGGCTTCACAATGGCAGCGATTCCCCCAGATTCCTGGCAGCCACCCTTN
HKR406202 RBdS015I10 pGCAP10 NM_016059.3  
TGATTCCGCCGCCGGCTTCGCTATGGCGGCAATTCCCCCAGATTCCTGGCAGCCACCCAA
HKR461960 RBdS154O24 pGCAP10 NM_016059.3  
GATTCCGCCGCCGGCTTCGCTATGGCGGCAATTCCCCCAGATTCCTGGCAGCCACCCAAC
HKR462544 RBdS156F24 pGCAP10 NM_016059.3  
GAGACAAGCATTCCGCCGCCGGCTTCGCTATGGCGGCAATTCCCCCAGATTCCTGGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl