Prev. |  KEGG KO K06890 > 

RIKEN DNA Bank Human Resource - TMBIM4

Gene ID NCBI Gene 51643 |  KEGG hsa:51643
Gene Symbol TMBIM4
Protein Name transmembrane BAX inhibitor motif containing 4
Synonyms CGI-119|GAAP|LFG4|S1R|ZPRO
Ortholog resource in our bank

  TMBIM4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099181 IRAL047P21 pOTB7 BC052273 NM_016056 Partial/var
HGY103058 IRAL057K18 pDNR-LIB BC070366 NM_016056 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084424 M01C011A24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084472 M01C011C24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084520 M01C011E24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084568 M01C011G24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084616 M01C011I24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084664 M01C011K24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084712 M01C011M24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  
HGE084760 M01C011O24 pDONR221 FLJ03-B12 AK075069 ENST00000286424  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064030 ARe60B06 pKA1U5 NM_016056.2  
GGCTGGGGCTGGGCTCTTCCTCGCGGAAGTGGGGAGGAGGCGGTTGCGGTTAGTGGACCG
HKR168930 ARi22F10 pGCAP10 NM_016056.2  
GGGGGCTGGGCTCTTCCTCGCGGAAGTGGGGAGGAGGCGGTTGCGGTTAGTGGACCGGGA
HKR187345 ARi68G01 pGCAP10 NM_016056.2  
GGGTTGCGGTTAGTGGACCGGGACCGGTAGGGGTGCTGTTGCCATCATGGCTGACCCCGA
HKR330970 RBb27H02 pGCAP1 NM_016056.2  
GCGGTTGCGGTTAGTGGACCGGGACCGGTAGGGGTGCTGTTGCCATCATGGCTGACCCCG
HKR405325 RBdS013F05 pGCAP10 NM_016056.2  
GGCGGTTAGTGGACCGGGACCGGTAGGGGTGCTGTTGCCATCATGGCTGACCCCGACCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl