Prev. |  KEGG KO K10417 > 

RIKEN DNA Bank Human Resource - DYNC2LI1

Gene ID NCBI Gene 51626 |  KEGG hsa:51626
Gene Symbol DYNC2LI1
Protein Name dynein cytoplasmic 2 light intermediate chain 1
Synonyms CGI-60|D2LIC|LIC3
Ortholog resource in our bank

  DYNC2LI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086709 IRAL016M21 pDNR-LIB BC006969 NM_016008 Full/var
HGY093006 IRAL032I14 pDNR-LIB BC016324 NM_015522 Full
HGY099223 IRAL048A23 pDNR-LIB BC058823 NM_015522 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085646 M01C014B22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085694 M01C014D22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085742 M01C014F22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085790 M01C014H22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085838 M01C014J22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085886 M01C014L22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085934 M01C014N22 pDONR221 FLJ04-H11 AK074206 NM_016008  
HGE085982 M01C014P22 pDONR221 FLJ04-H11 AK074206 NM_016008  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR340977 RBb52H09 pGCAP1 NM_015522.2  
GGCGGAGCTCGCCGCCTGATTCTAGGCTGGTCACTACTCCGAGCCTGTGACGTTTGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl