Prev. | 

RIKEN DNA Bank Human Resource - CCZ1

Gene ID NCBI Gene 51622 |  KEGG hsa:51622
Gene Symbol CCZ1
Protein Name CCZ1 homolog, vacuolar protein trafficking and biogenesis associated
Synonyms C7orf28A|CCZ1A|CGI-43|H_DJ1163J12.2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067171 IRAK167P11 pBluescriptR BC067810 NM_015622 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174572 ARi36H04 pGCAP10 NM_015622.5  
GGGGCCGTGGGAGGCTCCCGAGGTGGGGGCCGGGGCGGGATGGCTGCAGCGGCGGCCGGG
HKR186055 ARi65C07 pGCAP10 NM_015622.5  
GGGTGGCTGCTGTCTCTGGGCGGGCCGTGGGAGGCTCCCGAGGTGGGGGCCGGGGCGGGA
HKR222153 ARiS055G09 pGCAP10 NM_015622.5  
GGGGGGTCGGGGCGGGATGGCTGCAGCGGCGGCCGGGGCCGGGAGCGGGCCCTGGGCGGC
HKR361605 RBd04A05 pGCAP10 NM_015622.5  
GGTCTCTGGGCGGGCCGTGGGAGGCTCCCGAGGTGGGGGCCGGGGCGGGATGGCTGCAGC
HKR362404 RBd06A04 pGCAP10 NM_015622.5  
GGTGGGAGGCTCCCGAGGTGGGGGCCGGGGCGGGATGGCTGCAGCGGCGGCCGGGGCCGG
HKR365634 RBd14B10 pGCAP10 NM_015622.5  
GGTTTTAGCCGGTGGCTGCTGTCTCTGGGCGGGCCGTGGGAGGCTCCCGAGGTGGGGGCC
HKR416306 RBdS040M18 pGCAP10 NM_015622.5  
GGAGGTGGGGGCCGGGGCGGGATGGCTGCAGCGGCGGCCGGGGCCGGGAGCGGGCCCTGG
HKR474883 RBdS187D11 pGCAP10 NM_015622.5  
GGTCTCTGGGCGGGCGGTGGGAGGCTCCCGAGGTGGGGGCCGGGGCGGGATGGCTGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl