Prev. |  KEGG KO K00586 > 

RIKEN DNA Bank Human Resource - DPH5

Gene ID NCBI Gene 51611 |  KEGG hsa:51611
Gene Symbol DPH5
Protein Name diphthamide biosynthesis 5
Synonyms AD-018|CGI-30|HSPC143|NPD015
Ortholog resource in our bank

  DPH5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046143 IRAK115F23 pCMV-SPORT6 BC053857 NM_015958 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095621 M01C039A21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095669 M01C039C21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095717 M01C039E21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095765 M01C039G21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095813 M01C039I21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095861 M01C039K21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095909 M01C039M21 pDONR221 MGC09-A11 BC053857 ENST00000370107  
HGE095957 M01C039O21 pDONR221 MGC09-A11 BC053857 ENST00000370107  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163355 ARi08G11 pGCAP10 NM_015958.2  
GCTTTTCTCTGCACGGAGCCGGCGCTTTTGCAGTTGCTTCTGCGGAAAGGTGGTAGTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl