Prev. |  KEGG KO K02144 > 

RIKEN DNA Bank Human Resource - ATP6V1H

Gene ID NCBI Gene 51606 |  KEGG hsa:51606
Gene Symbol ATP6V1H
Protein Name ATPase H+ transporting V1 subunit H
Synonyms CGI-11|MSTP042|NBP1|SFD|SFDalpha|SFDbeta|VMA13
Featured content Lysosome (human)
Ortholog resource in our bank

  ATP6V1H

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081443 IRAL003K03 pOTB7 BC007454 NM_213620 Full/var
HGY084054 IRAL010C06 pOTB7 BC007421 NM_213620 Full/var
HGY096929 IRAL042F09 pOTB7 BC025275 NM_213620 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277795 ARiS194I03 pGCAP10 NM_015941.2  
GAGTTTCTCCAGCTTGCCTGGTGCGTGCTGGTGTCTCGCCGCTTGGTCCTCTCCTGTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl