Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP6V1H

Gene ID (NCBI) 51606
Gene Symbol ATP6V1H
Protein Name ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Synonyms MSTP042|NBP1|SFD|SFDalpha|SFDbeta|VMA13
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081443 IRAL003K03 pOTB7 BC007454 NM_213620 Full/var
HGY084054 IRAL010C06 pOTB7 BC007421 NM_213620 Full/var
HGY096929 IRAL042F09 pOTB7 BC025275 NM_213620 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277795 ARiS194I03 pGCAP10 NM_015941.2  
GAGTTTCTCCAGCTTGCCTGGTGCGTGCTGGTGTCTCGCCGCTTGGTCCTCTCCTGTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl