Prev. |  KEGG KO K05292 > 

RIKEN DNA Bank Human Resource - PIGT

Gene ID NCBI Gene 51604 |  KEGG hsa:51604
Gene Symbol PIGT
Protein Name phosphatidylinositol glycan anchor biosynthesis class T
Synonyms CGI-06|MCAHS3|NDAP|PNH2
Ortholog resources KEGG ortholog (KEGG orthology K05292) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006315 IRAK015N03 pCMV-SPORT6 BC015022 NM_015937 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056902 ARe42E06 pKA1U5 NM_015937.3  
GGGAAGTAGCCGCAGGCATGGCGGCGGCTATGCCGCTTGCTCTGCTCGTCCTGTTGCTCC
HKR061373 ARe53H05 pKA1U5 NM_015937.3  
GGGAAGTAGCCGCAGGCATGGCGGCGGCTATGCCGCTTGCTCTGCTCGTCCTGTTGCTCC
HKR208087 ARiS020D15 pGCAP10 NM_015937.3  
GGTAGCCGCAGGCATGGCGGCGGCTATGCCGCTTGCTCTGCTCGTCCTGTTGCTCCTGGG
HKR249130 ARiS122N18 pGCAP10 NM_015937.3  
GGGAAGTAGCCGCAGGCATGGCGGCGGCTATGCCGCTTGCTCTGCTCGTCCTGTTGCTCC
HKR376052 RBd40C04 pGCAP10 NM_015937.3  
GGGAAGTAGCCGCAGGCATGGCGGCGGCTATGCCGCTTGCTCTGCTCGTCCTGTTGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl