Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SRRT

Gene ID (NCBI) 51593
Gene Symbol SRRT
Protein Name serrate RNA effector molecule homolog (Arabidopsis)
Synonyms ARS2|ASR2|serrate
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083083 IRAL007L19 pOTB7 BC000082 NM_182800 Partial
HGY101729 IRAL054F09 pOTB7 BC069249 NM_182800 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR360483 RBd01D11 pGCAP10 NM_015908.5  
GGTTCGCCTCTCTTCGGCCCTCTACTCAAGAGCTCCGTCTCCGTCTCGCCCTCCTCGAAG
HKR340011 RBb50A11 pGCAP1 NM_015908.5  
GCCCACTTTTGTTCGCCTCTCTTCGGCCCTCTACTCAAGAGCTCCGATCTCCGGTCTCGC
HKR405356 RBdS013G12 pGCAP10 NM_015908.5  
TGGCNNGNGCAGCGCGGNCTGCGCGCGCTACTGCCCATCCCCGGTTGTCCCACTTTTGTT
HKR405401 RBdS013I09 pGCAP10 NM_015908.5  
GGCGGGCTGCGCGCGCTACTGCCCATCCCCGGTTGTCCCACTTTTGTTCGCCTCTCTTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl