Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PIAS4

Gene ID (NCBI) 51588
Gene Symbol PIAS4
Protein Name protein inhibitor of activated STAT, 4
Synonyms PIASY|Piasg|ZMIZ6
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Jak-STAT signaling pathwa (human)
Featured content NF-kappa B signaling pathway (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX020710 IRAK051M22 pCMV-SPORT6 BC029874 NM_015897
HGY067031 IRAK167J15 pBluescriptR BC066895 NM_015897 Full/var
HGY090993 IRAL027I01 pOTB7 BC010047 NM_015897 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081653 ARf04C05 pKA1U5 NM_015897.2  
GGGTGACCAAGATGGCGGCGGAGCTGGTGGAGGCCAAAAACATGGTGATGAGTTTTCGAG
HKR452931 RBdS132F11 pGCAP10 NM_015897.2  
GGGTGACCAAGATGGCGGCGGAGCTGGTGGAGGCCAAAAACATGGTGATGAGTTTTCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl