Prev. |  KEGG KO K16065 > 

RIKEN DNA Bank Human Resource - PIAS4

Gene ID NCBI Gene 51588 |  KEGG hsa:51588
Gene Symbol PIAS4
Protein Name protein inhibitor of activated STAT 4
Synonyms PIAS-gamma|PIASY|Piasg|ZMIZ6
Featured content Jak-STAT signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Ortholog resource in our bank

  PIAS4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020710 IRAK051M22 pCMV-SPORT6 BC029874 NM_015897
HGY067031 IRAK167J15 pBluescriptR BC066895 NM_015897 Full/var
HGY090993 IRAL027I01 pOTB7 BC010047 NM_015897 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081653 ARf04C05 pKA1U5 NM_015897.2  
GGGTGACCAAGATGGCGGCGGAGCTGGTGGAGGCCAAAAACATGGTGATGAGTTTTCGAG
HKR452931 RBdS132F11 pGCAP10 NM_015897.2  
GGGTGACCAAGATGGCGGCGGAGCTGGTGGAGGCCAAAAACATGGTGATGAGTTTTCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl