DNA Bank Top |  KEGG KO K15191 > 

RIKEN DNA Bank Human Resource - LARP7

Gene ID NCBI Gene 51574 |  KEGG hsa:51574
Gene Symbol LARP7
Protein Name La ribonucleoprotein 7, transcriptional regulator
Synonyms ALAZS|HDCMA18P|PIP7S|hLARP7

Link

Ortholog resource in our bank

  LARP7


External database

human LARP7

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04592 SEREX clone NGO-Br-36 (ID 851, 852) #1 SEREX clone NGO-Br-36 (ID 851, 852) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066995 IRAK167I03 pBluescriptR BC066945 NM_016648 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE126011 M01C115A11 pDONR221 1_5-A06 AK000274 ENST00000308878  
HGE085618 M01C014A18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085666 M01C014C18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085714 M01C014E18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085762 M01C014G18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085810 M01C014I18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085858 M01C014K18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085906 M01C014M18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  
HGE085954 M01C014O18 pDONR221 FLJ04-F09 AK000274 ENST00000308878  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405964 RBdS014P04 pGCAP10 NM_015454.1  
CGGCCGGCCGATGATCCTATGACGCGAAAGTAACCGAGACTATCAGGATCCGGAGACGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl