Prev. |  KEGG KO K19179 > 

RIKEN DNA Bank Human Resource - GDE1

Gene ID NCBI Gene 51573 |  KEGG hsa:51573
Gene Symbol GDE1
Protein Name glycerophosphodiester phosphodiesterase 1
Synonyms 363E6.2|MIR16
Ortholog resource in our bank

  GDE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093688 IRAL034D16 pOTB7 BC014981 NM_016641 Full
HGY097114 IRAL042N02 pOTB7 BC025273 NM_016641 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162126 ARi05F06 pGCAP10 NM_016641.3  
GGCTTCTCGTTCTACTGCCCCAGGAGCCCGGCGGGTCCGGGACTCCCGTCCGTGCCGGTG
HKR188082 ARi70D10 pGCAP10 NM_016641.3  
GCTACTGCCCCAGGAGCCCGGCGGGTCCGGGACTCCCGTCCGTGCCGGTGCGGGCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl