Prev. | 

RIKEN DNA Bank Human Resource - CYRIB

Gene ID NCBI Gene 51571 |  KEGG hsa:51571
Gene Symbol CYRIB
Protein Name CYFIP related Rac1 interactor B
Synonyms BM-009|CYRI|CYRI-B|FAM49B|L1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082472 IRAL006C24 pOTB7 BC003599 NM_016623 Full
HGY092651 IRAL031K11 pDNR-LIB BC016345 NM_016623 Full/var
HGY095898 IRAL039M10 pOTB7 BC017297 NM_016623

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234001 ARiS085A01 pGCAP10 NM_016623.3  
GCCTCCCCGCTCGGAGCTGCCGCCTGGCTTGTCGCGGCTCTGCCACAGGGGCAGGTGTTG
HKR382552 RBd56G08 pGCAP10 NM_016623.3  
GAGGTGTTGAGGGGCTCCCGGTCCGGCTGCCGCCGCTCCCCCGCNCCGGACCCGGGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl