Prev. | 

RIKEN DNA Bank Human Resource - ARMCX3

Gene ID NCBI Gene 51566 |  KEGG hsa:51566
Gene Symbol ARMCX3
Protein Name armadillo repeat containing, X-linked 3
Synonyms ALEX3|GASP6|dJ545K15.2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086771 IRAL016P11 pDNR-LIB BC005194 NM_177948 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375780 RBd39H12 pGCAP10 NM_016607.3  
GCCCGTCTGAGTACCAGCTCCCCACTGCCCTGAGGGCGGGCCGGCCTGCGGCGGAGGGAA
HKR392433 RBd81B09 pGCAP10 NM_016607.3  
GGTTGTTCCCGTCTGAGTACCAGCTCCCCACTGCCCTGAGGGCGGGCCGGCCTGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl