Prev. | 

RIKEN DNA Bank Human Resource - ZNF581

Gene ID NCBI Gene 51545 |  KEGG hsa:51545
Gene Symbol ZNF581
Protein Name zinc finger protein 581
Synonyms HSPC189
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066479 IRAK166D07 pCMV-SPORT6 BC071620 NM_016535 Full
HGY083543 IRAL008O07 pOTB7 BC001219 NM_016535 Full
HGY090862 IRAL027C14 pOTB7 BC010097 NM_016535 Full
HGY103280 IRAL058D08 pOTB7 BC071845 NM_016535 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380504 RBd51E08 pGCAP10 NM_016535.3  
GCTTTCGGCCGGCGCCGCCAGTTCCTGGGGCACACCCAGAGGTCCCCTTCTCGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl