Prev. | 

RIKEN DNA Bank Human Resource - ZCCHC17

Gene ID NCBI Gene 51538 |  KEGG hsa:51538
Gene Symbol ZCCHC17
Protein Name zinc finger CCHC-type containing 17
Synonyms HSPC251|PS1D|pNO40
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044367 IRAK110P07 pCMV-SPORT6 BC050609 NM_016505 Full
HGY082270 IRAL005L06 pOTB7 BC000685 NM_016505 Partial
HGY084062 IRAL010C14 pOTB7 BC007446 NM_016505 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234286 ARiS085L22 pGCAP10 NM_016505.2  
GGTTTAGTTCAGCGCAGCGACTCGGGGACCTGGAGCTGACGCCTAGACACTTGTATTAGC
HKR365349 RBd13G05 pGCAP10 NM_016505.2  
GGACGCCTAGTACGTATGAGGAAGAACGGGGTGGGTGGCTGCCTGAGTCTGGAGGCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl