Prev. |  KEGG KO K17981 > 

RIKEN DNA Bank Human Resource - MTFP1

Gene ID NCBI Gene 51537 |  KEGG hsa:51537
Gene Symbol MTFP1
Protein Name mitochondrial fission process 1
Synonyms HSPC242|MTP18
Ortholog resource in our bank

  MTFP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032811 IRAK082A11 pCMV-SPORT6 BC038831 NM_016498 Full
HGX042832 IRAK107B08 pCMV-SPORT6 BC046132 NM_016498 Full
HGY083304 IRAL008E08 pOTB7 BC001608 NM_016498 Full
HGY090555 IRAL026G11 pOTB7 BC009300 NM_016498 Full
HGY093687 IRAL034D15 pOTB7 BC014446 NM_016498 Full
HGY096445 IRAL041B21 pDNR-LIB BC030989 NM_016498 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR025373 ARa63H05 pKA1U5 NM_016498.3  
GAGACCCAAGTGCCGGCGGCGGAGACTGCAGTGGAGCCAGTACCGGCTGTAGTGGCCGGG
HKR441941 RBdS104O05 pGCAP10 NM_016498.3  
GGCTCCCTGCTGGCGGAGATTTCCTGACCTGTCCTTCGGCGCGGGACTTTCGGCGGGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl