Prev. |  KEGG KO K12199 > 

RIKEN DNA Bank Human Resource - VTA1

Gene ID NCBI Gene 51534 |  KEGG hsa:51534
Gene Symbol VTA1
Protein Name vesicle trafficking 1
Synonyms C6orf55|DRG-1|DRG1|HSPC228|LIP5|My012|SBP1
Ortholog resources KEGG ortholog (KEGG orthology K12199) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013127 IRAK032N15 pBluescriptR BC022536 NM_016485 Full
HGY086470 IRAL016C22 pDNR-LIB BC006989 NM_016485 Full
HGY088613 IRAL021I21 pDNR-LIB BC005937 NM_016485 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056835 ARe42B11 pKA1U5 NM_016485.3  
GGGTGAGTTCGGAGTAGAGATGGCCGCGCTTGCACCGCTGCCCCCGCTCCCCGCACAGTT
HKR209374 ARiS023H06 pGCAP10 NM_016485.3  
GAGGAAGTGGTGAGTTCGGAGTAGAGATGGCCGCGCTTGCACCGCTGCCCCCGCTCCCCG
HKR248877 ARiS122D05 pGCAP10 NM_016485.3  
GGGTGAGTTCGGAGTAGAGATGGCCGCGCTTGCACCGCTGCCCCCGCTCCCCGCACAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl