Prev. | 

RIKEN DNA Bank Human Resource - GSKIP

Gene ID NCBI Gene 51527 |  KEGG hsa:51527
Gene Symbol GSKIP
Protein Name GSK3B interacting protein
Synonyms C14orf129|HSPC210
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001520 IRAK003N08 pCMV-SPORT6 BC004818 NM_016472

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR331603 RBb29A03 pGCAP1 NM_016472.3  
GGGGGCGGAAGAAGGCGGGGAGGGAGGGGGCGGCACCGCCGGTCGGCTCCAGTCGCCTCC
HKR408888 RBdS022D16 pGCAP10 NM_016472.3  
GAGTCGCCTCCGGAGGAAGGAAGAAGAGGACGCCGGGCGCGCAGCTCGGTGCTGATTATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl