Prev. | 

RIKEN DNA Bank Human Resource - CXXC5

Gene ID NCBI Gene 51523 |  KEGG hsa:51523
Gene Symbol CXXC5
Protein Name CXXC finger protein 5
Synonyms CF5|HSPC195|RINF|WID
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004948 IRAK012G04 pCMV-SPORT6 BC050046 NM_016463 Full
HGY081653 IRAL004C05 pOTB7 BC002490 NM_016463 Full
HGY087085 IRAL017L21 pOTB7 BC041013 NM_016463 Full
HGY087236 IRAL018B12 pOTB7 BC017439 NM_016463 Full
HGY087257 IRAL018C09 pOTB7 BC006428 NM_016463
HGY087464 IRAL018K24 pOTB7 BC024040 NM_016463 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068975 ARe72H07 pKA1U5 NM_016463.7  
GATAGCTCCTGCCCGGGCGGGCGCGCGGCGGCGGCNNCAGAGGCGGCTGAGCCTGAGCGG
HKR070053 ARe75C05 pKA1U5 NM_016463.7  
GCTGCCCGGGCGGGCGCGCGGCGGCGGCGGCACCATGTNGCTGAGCCTGAGCGGGGATGT
HKR433492 RBdS083M04 pGCAP10 NM_016463.7  
GACTGGCGGCAAGAGCAGACGCCCGAGCCGAGCGAGAAGAGCGGCAGAGCCTTATCCCCT
HKR461838 RBdS154J22 pGCAP10 NM_016463.7  
GAGAGCAGACGCCCGAGCCGAGCGAGAAGAGCGGCAGAGCCTTATCCCCTGAAGCCGGGC
HKR471154 RBdS177O18 pGCAP10 NM_016463.7  
GATAGCTCCTGCCCGGGCGGGCGCGCGGCGGCGGCGGCAGAGGCGGCTGAGCCTGAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl