Prev. |  KEGG KO K11790 > 

RIKEN DNA Bank Human Resource - DTL

Gene ID NCBI Gene 51514 |  KEGG hsa:51514
Gene Symbol DTL
Protein Name denticleless E3 ubiquitin protein ligase homolog
Synonyms CDT2|DCAF2|L2DTL|RAMP
Ortholog resource in our bank

  DTL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011624 IRAK029A24 pCMV-SPORT6 BC033297 NM_016448 Full
HGY028754 IRAK071O18 pBluescriptR BC033540 NM_016448 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279447 ARiS198K07 pGCAP10 NM_016448.2  
GAATTGAgTTGGAgGCGATaaCgAtTTGTGTtgtGAGaGGGGCaaCCTgCgATTTCTGCt
HKR433393 RBdS083I01 pGCAP10 NM_016448.2  
GAGGCGATAACGATTTGTGTTGTGAGAGGCGCAAGCTGCGATTTCTGCTGAACTTGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl