Prev. |  KEGG KO K10129 > 

RIKEN DNA Bank Human Resource - GTSE1

Gene ID NCBI Gene 51512 |  KEGG hsa:51512
Gene Symbol GTSE1
Protein Name G2 and S-phase expressed 1
Synonyms B99
Ortholog resources KEGG ortholog (KEGG orthology K10129) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087055 IRAL017K15 pOTB7 BC006325 NM_016426 Full
HGY103336 IRAL058F16 pOTB7 BC075828 NM_016426 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178057 ARi45C09 pGCAP10 NM_016426.5  
GGCGTTTAAATCCGTGCCGGAGGCGCGTCCTGCATCGTCTGCCGCTTTGGTGACTTCTGA
HKR336173 RBb40H05 pGCAP1 NM_016426.5  
TGGGTCTCCCGGCGCCGCGTTTAAATCCGTGCCGGAGGCGCGTCCTGCATCGTCTGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl