Prev. |  KEGG KO K12165 > 

RIKEN DNA Bank Human Resource - UFC1

Gene ID NCBI Gene 51506 |  KEGG hsa:51506
Gene Symbol UFC1
Protein Name ubiquitin-fold modifier conjugating enzyme 1
Synonyms HSPC155
Ortholog resources KEGG ortholog (KEGG orthology K12165) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086516 IRAL016E20 pDNR-LIB BC005187 NM_016406 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080927 ARf02F07 pKA1U5 NM_016406.3  
GGCGCCCTGGTCCAAGATGGCGGATGAAGCCACGCGACGTGTTGTGTCTGAGATCCCGGT
HKR391704 RBd79E08 pGCAP10 NM_016406.3  
GGCGCCCTGGTCCAAGATGGCGGATGAAGCCACGCGACGTGTTGTGTCTGAGATCCCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl