Prev. |  KEGG KO K12863 > 

RIKEN DNA Bank Human Resource - CWC15

Gene ID NCBI Gene 51503 |  KEGG hsa:51503
Gene Symbol CWC15
Protein Name CWC15 spliceosome associated protein homolog
Synonyms AD002|C11orf5|Cwf15|HSPC148|ORF5
Ortholog resource in our bank

  CWC15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033963 IRAK084P03 pCMV-SPORT6 BC040946 NM_016403 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048576 ARe21H08 pKA1U5 NM_016403.3  
GGCTAGCTCTGGGCGCAGAGGTTTCTGGGAGCCAAGAGTGGTAATGGCGTCTGTATGATC
HKR072830 ARe82B06 pKA1U5 NM_016403.3  
TGAAGAGTGGTAATGGCGTCTGTATGATCTTCGGAGCCTGCTGCATCGGACCTCGGCCAG
HKR073372 ARe83H04 pKA1U5 NM_016403.3  
GTCTGGGAGCCAAGAGTGGTAATGGCGTCTGTATGATCTTCGGAGCCTGCTGCATCGGAC
HKR219795 ARiS049I03 pGCAP10 NM_016403.3  
GGTTTCTGGGAGCCAAGAGTGGTAATGGCGTCTGTATGATCTTCGGAGCCTGCTGCATCG
HKR376431 RBd41B07 pGCAP10 NM_016403.3  
GGCGCAGAGGTTTCTGGGAGCCAAGAGTGGTAATGGCGTCTGTATGATCTTCGGAGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl