Prev. |  KEGG KO K17968 > 

RIKEN DNA Bank Human Resource - TRIAP1

Gene ID NCBI Gene 51499 |  KEGG hsa:51499
Gene Symbol TRIAP1
Protein Name TP53 regulated inhibitor of apoptosis 1
Synonyms HSPC132|MDM35|P53CSV|WF-1
Ortholog resource in our bank

  TRIAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084859 IRAL012C11 pOTB7 BC002638 NM_016399 Full
HGY099250 IRAL048C02 pDNR-LIB BC055313 NM_016399 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076432 ARe91B08 pKA1U5 NM_016399.2  
ACTGTCGCCATGAACAGTGTGGGGGAGGCATGCACGGTACATGAAGCGCGAGTACGACCA
HKR164811 ARi12A11 pGCAP10 NM_016399.2  
GGAACAGTGTGGGGGAGGCATGCACGGACATGAAGCGCGAGTACGACCAGTGCTTCAATC
HKR169674 ARi24D02 pGCAP10 NM_016399.2  
GGAACAGTGTGGGGGAGGCATGCACGGACATGAAGCGCGAGTACGACCAGTGCTTCAATC
HKR218304 ARiS045M16 pGCAP10 NM_016399.2  
GACTGTCGCCATGAACAGTGTGGGGGAGGCATGCACGGACATGAAGCGCGAGTACGACCA
HKR365701 RBd14E05 pGCAP10 NM_016399.2  
GACTGTCGCCATGAACAGTGTGGGGGAGGCATGCACGGACATGAAGCGCGAGTACGACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl