Prev. |  KEGG KO K17616 > 

RIKEN DNA Bank Human Resource - CTDSPL2

Gene ID NCBI Gene 51496 |  KEGG hsa:51496
Gene Symbol CTDSPL2
Protein Name CTD small phosphatase like 2
Synonyms HSPC058|HSPC129
Ortholog resources KEGG ortholog (KEGG orthology K17616) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031864 IRAK079K24 pCMV-SPORT6 BC035744 NM_016396 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094425 M01C036B01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094473 M01C036D01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094521 M01C036F01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094569 M01C036H01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094617 M01C036J01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094665 M01C036L01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094713 M01C036N01 pDONR221 MGC07-G01 BC035744 ENST00000260327  
HGE094761 M01C036P01 pDONR221 MGC07-G01 BC035744 ENST00000260327  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR402967 RBdS007G23 pGCAP10 NM_016396.2  
GGCTTTCCATCCGGGTCCCTGTCCGTGCGGTGCAGCAGGTCGGTAGGCGGGAAATGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl