Prev. |  KEGG KO K13373 > 

RIKEN DNA Bank Human Resource - HSD17B7

Gene ID NCBI Gene 51478 |  KEGG hsa:51478
Gene Symbol HSD17B7
Protein Name hydroxysteroid 17-beta dehydrogenase 7
Synonyms PRAP|SDR37C1
Ortholog resources KEGG ortholog (KEGG orthology K13373) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056135 IRAK140F15 pCMV-SPORT6 BC065246 NM_016371 Full
HGY086718 IRAL016N06 pDNR-LIB BC007068 NM_016371 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005916 W01A014N04 pENTR-TOPO IRAK140F15 BC065246 NM_016371  
HGE005918 W01A014N06 pENTR-TOPO IRAK140F15 BC065246 NM_016371  
HGE005920 W01A014N08 pENTR-TOPO IRAK140F15 BC065246 NM_016371  
HGE005928 W01A014N16 pENTR-TOPO IRAL016N06 BC007068 NM_016371  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR433515 RBdS083N03 pGCAP10 NM_016371.2  
GGGCGTTTGCTTCACTGCTTGGAAGTGTGAGTGCGCGAAGATGCGAAAGGTGGTTTTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl