Prev. | 

RIKEN DNA Bank Human Resource - EVL

Gene ID NCBI Gene 51466 |  KEGG hsa:51466
Gene Symbol EVL
Protein Name Enah/Vasp-like
Synonyms RNB6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025938 IRAK064O02 pCMV-SPORT6 BC032358 NM_016337 Full
HGY080971 IRAL002H03 pOTB7 BC023997 NM_016337 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE093635 M01C034B11 pDONR221 MGC06-G06 BC032358 NM_016337  
HGE093683 M01C034D11 pDONR221 MGC06-G06 BC032358 NM_016337  
HGE093731 M01C034F11 pDONR221 MGC06-G06 BC032358 NM_016337 done
HGE093779 M01C034H11 pDONR221 MGC06-G06 BC032358 NM_016337  
HGE093827 M01C034J11 pDONR221 MGC06-G06 BC032358 NM_016337  
HGE093875 M01C034L11 pDONR221 MGC06-G06 BC032358 NM_016337  
HGE093923 M01C034N11 pDONR221 MGC06-G06 BC032358 NM_016337  
HGE093971 M01C034P11 pDONR221 MGC06-G06 BC032358 NM_016337  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362002 RBd05A02 pGCAP10 NM_016337.2  
GCCTCGAGGACTCGGAGCCGCCCGCGCACTCGCCAGGGGCCGCCGCCCCGAGTCTCAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl