Prev. |  KEGG KO K18203 > 

RIKEN DNA Bank Human Resource - LCMT1

Gene ID NCBI Gene 51451 |  KEGG hsa:51451
Gene Symbol LCMT1
Protein Name leucine carboxyl methyltransferase 1
Synonyms CGI-68|LCMT|PPMT1
Ortholog resource in our bank

  LCMT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083545 IRAL008O09 pOTB7 BC001214 NM_016309 Full
HGY092034 IRAL030B10 pOTB7 BC014217 NM_016309 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057231 ARe43B07 pKA1U5 NM_016309.2  
GGAGCCGCGCCAGCTGAGCCAGGTAGGGCCCTACCCTCTTCTGTTGCTTTCTCCCTGTGG
HKR325375 RBb13H07 pKA1U5 NM_016309.2  
GGTCACTGAGCCGCGCCAGCTGAGCCAGGTAGGGCCCTACCCTCTTCTGTTGCTTTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl