Prev. |  KEGG KO K07756 > 

RIKEN DNA Bank Human Resource - IP6K2

Gene ID NCBI Gene 51447 |  KEGG hsa:51447
Gene Symbol IP6K2
Protein Name inositol hexakisphosphate kinase 2
Synonyms IHPK2|PIUS
Ortholog resources KEGG ortholog (KEGG orthology K07756) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011977 IRAK029P17 pCMV-SPORT6 BC019694 NM_001005913 Partial
HGX056307 IRAK140M19 pCMV-SPORT6 BC065533 NM_001005913 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR393307 RBd83E11 pGCAP10 NM_016291.2  
GGGAAAACGCCGAGGAACCCGGCTGAGGCGGCAGCAGAGCATCCTGGCCAGAACAAGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl