Prev. |  KEGG KO K20102 > 

RIKEN DNA Bank Human Resource - YTHDF2

Gene ID NCBI Gene 51441 |  KEGG hsa:51441
Gene Symbol YTHDF2
Protein Name YTH N6-methyladenosine RNA binding protein 2
Synonyms CAHL|HGRG8|NY-REN-2
Ortholog resource in our bank

  YTHDF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081887 IRAL004L23 pOTB7 BC002559 NM_016258 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330456 RBb26C08 pGCAP1 NM_016258.2  
GAGTCGGAGCCGGAGCCTGAGCCGCGCGCTGTGTCTCCGCTGCGTCCGCCGAGGCCCCCG
HKR387207 RBd68A07 pGCAP10 NM_016258.2  
GCCTTTCGGTGTGTTCTTGCAGCTGGCGAACAGCTTTTTCGCTAACAAGGAGTAATTCAT
HKR471085 RBdS177L21 pGCAP10 NM_016258.2  
GGACAAAAGCCTCCGCCTGCTCCCGCAGACGGGGCTCATCTGCCGCCGCCGCCGCGCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl