Prev. | 

RIKEN DNA Bank Human Resource - SCARA3

Gene ID NCBI Gene 51435 |  KEGG hsa:51435
Gene Symbol SCARA3
Protein Name scavenger receptor class A member 3
Synonyms APC7|CSR|CSR1|MSLR1|MSRL1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053237 IRAK133B13 pBluescript BC060811 NM_182826 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113621 M01C084A21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113669 M01C084C21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113717 M01C084E21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113765 M01C084G21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113813 M01C084I21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113861 M01C084K21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113909 M01C084M21 pDONR221 IMS05-E11 BC060811 NM_182826  
HGE113957 M01C084O21 pDONR221 IMS05-E11 BC060811 NM_182826  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055752 ARe39G08 pKA1U5 NM_016240.2  
GCGGCGGGGCGCGTCCGCTAGGCGCCCGGCGGGGCTTCNCCAGGCTGCGACCCCGCGGGA
HKR277625 ARiS194B01 pGCAP10 NM_016240.2  
GGAGGAGCAGGCGGGAAGGAGGGAGGGAGGAAGGGNGNANGGGNCNANGGGCGGNNNNTT
HKR385707 RBd64E11 pGCAP10 NM_016240.2  
GAGACCTCGCGGGGCCCCAGCGGGAAGCGCGGGCGGCGGCGGGATGCGCGCTCTGGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl