Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANAPC7

Gene ID (NCBI) 51434
Gene Symbol ANAPC7
Protein Name anaphase promoting complex subunit 7
Synonyms APC7
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03354)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033956 IRAK084O20 pCMV-SPORT6 BC040130 NM_016238 Partial/var
HGY086300 IRAL015M12 pOTB7 BC002941 NM_016238 Partial/var
HGY090210 IRAL025I18 pOTB7 BC009498 NM_016238 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235033 ARiS087J17 pGCAP10 NM_016238.2  
GGGNGNCTCNNCNNGNTCCNCTACCGGCTTTTCGAGTCAGTGCTGCCGCCGCTGCCCGCG
HKR370874 RBd27D02 pGCAP10 NM_016238.2  
GAAGGATCCTCTACCGGCTTTTCGAGTCAGTGCTGCCGCCGCTGCCCGCGGCTTTGCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl