Prev. |  KEGG KO K03352 > 

RIKEN DNA Bank Human Resource - ANAPC5

Gene ID NCBI Gene 51433 |  KEGG hsa:51433
Gene Symbol ANAPC5
Protein Name anaphase promoting complex subunit 5
Synonyms APC5
Ortholog resource in our bank

  ANAPC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004822 IRAK012A22 pCMV-SPORT6 BC034243 NM_016237 Partial
HGY081175 IRAL002P15 pOTB7 BC001081 NM_016237 Full
HGY083848 IRAL009K08 pOTB7 BC001950 NM_016237 Full
HGY086849 IRAL017C01 pOTB7 BC006301 NM_016237

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008458 W01A021C10 pENTR-TOPO IRAL017C01 BC006301 NM_016237  
HGE038253 W01A095K13 pENTR-TOPO IRAL002P15 BC001081 NM_016237  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179207 ARi48A07 pGCAP10 NM_016237.4  
AACTGGCGGCAGCGCGCCGCGGGCCCGAGACTTAGTCTCGGGCCGCCATGGCCAGCGTCC
HKR368900 RBd22E04 pGCAP10 NM_016237.4  
HKR462647 RBdS156K07 pGCAP10 NM_016237.4  
GAGACCCGGTAGTGTTGTGCCTTGTGGTGACAACTGGCGGCAGCGCGCCGCGGGCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl