Prev. |  KEGG KO K17923 > 

RIKEN DNA Bank Human Resource - SNX9

Gene ID NCBI Gene 51429 |  KEGG hsa:51429
Gene Symbol SNX9
Protein Name sorting nexin 9
Synonyms SDP1|SH3PX1|SH3PXD3A|WISP
Ortholog resource in our bank

  SNX9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081092 IRAL002M04 pOTB7 BC001084 NM_016224 Partial
HGY087448 IRAL018K08 pOTB7 BC005022 NM_016224 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE032751 W01A081O15 pENTR-TOPO IRAL018K08 BC005022 NM_016224  
HGE032757 W01A081O21 pENTR-TOPO IRAL018K08 BC005022 NM_016224  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209354 ARiS023G10 pGCAP10 NM_016224.3  
GAGGAACTGCAGGAGCGTGCGGCGCGGGAGTAGCCGAGCGCCCAGCGGCTGGGCCTGAGC
HKR399773 RBd99H05 pGCAP10 NM_016224.3  
GAGGGGCGGGGGCCGCGCAGCCGGGGACTTTCAGGAACTGCAGGAGCGTGCGGCGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl