RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DDX41

Gene ID	NCBI Gene 51428 \| KEGG hsa:51428
Gene Symbol	DDX41
Protein Name	DEAD-box helicase 41
Synonyms	ABS\|MPLPF

Ortholog resource in our bank

  DDX41

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR329207	RBb23A07	pGCAP1	NM_016222.2	Full
HKR329207	TGGAAAGAATGGAGGAGTCGGAACCCGAACGGAAGCGGGCTCGCACCGACGAGGTGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl