Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOL7

Gene ID (NCBI) 51406
Gene Symbol NOL7
Protein Name nucleolar protein 7, 27kDa
Synonyms C6orf90|PQBP3|RARG-1|dJ223E5.2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087079 IRAL017L15 pOTB7 BC023517 NM_016167 Full
HGY100736 IRAL051N24 pDNR-LIB BC062683 NM_016167 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081747 ARf04G03 pKA1U5 NM_016167.3  
GGGTCTAGCGCTGCGTGGGCCATGGTTGCAGCTCCGACCGCGAGCGTCTCGCGCCCCGGC
HKR205429 ARiS013J13 pGCAP10 NM_016167.3  
GAGACGGTCTAGCGCTGCGTGGGCCATGGTGCAGCTCCGACCGCGAGCGTCTCGCGCCCC
HKR324172 RBb10H04 pKA1U5 NM_016167.3  
GAGACGGTCTAGCGCTGCGTGGGCCATGGTGCAGCTTCCGACCGCGAGCGTCTCGCGCCC
HKR367306 RBd18E10 pGCAP10 NM_016167.3  
TGCTAGCGCTGCGTGGGCCATGGTGCAGCTCCGACCGCGAGCGTCTCGCGCCCCGGCGTC
HKR328122 RBb20F02 pKA1U5 NM_016167.3  
GAGCGCTGCGTGGGCCATGGTGCAGCTCCGACCGCNTAGCGTCTCGCGCCCCGGCGTCGG
HKR336578 RBb41H10 pGCAP1 NM_016167.3  
GGGCGTCGGCGGAGGCGATGGTGGACGAGGGCCAGCTGGCCTCGGAGGAGGAGGAGGCGG
HKR340932 RBb52F12 pGCAP1 NM_016167.3  
GAGAGGTCAGACGGTCTAGCGCTTGCGTGGGCCATGGTGCAGCTTCCGACCGCGAGCGTC
HKR347230 RBb68B06 pGCAP1 NM_016167.3  
GGGTCTAGCGCTGCGTGGGCCATGGTGCAGCTCCGACCGCGAGCGTCTCGCGCCCCGGCG
HKR408834 RBdS022B10 pGCAP10 NM_016167.3  
GAGACGGTCTAGCGCTGCGTGGGCCATGGTGCAGCTCCGACCGCGAGCGTCTCGCGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl