Prev. |  KEGG KO K13617 > 

RIKEN DNA Bank Human Resource - PPME1

Gene ID NCBI Gene 51400 |  KEGG hsa:51400
Gene Symbol PPME1
Protein Name protein phosphatase methylesterase 1
Synonyms ABDH19|PME-1
Ortholog resources KEGG ortholog (KEGG orthology K13617) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044275 IRAK110L11 pCMV-SPORT6 BC050705 NM_016147 Full
HGY083375 IRAL008H07 pOTB7 BC003046 NM_016147 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065349 ARe63G05 pKA1U5 NM_016147.1  
ATCCTGGCTCTCGCCCACCTCTACCCGGCAGCGGGGGCAGTCAGAGCGGAGCCAAGATGC
HKR066060 ARe65C12 pKA1U5 NM_016147.1  
GGTTAGGGGAGCGAGTCGTGACCGGTTGGGCCACACTCAACGNTGGGACGAAGCTTCGCC
HKR182081 ARi55D09 pGCAP10 NM_016147.1  
GGTTAGGGGAGCGAGTCGTGACCGGTTGGGCCACACTCAACGTGGGACGAAGCTTCGCCT
HKR184801 ARi62A01 pGCAP10 NM_016147.1  
GAGGCGGTGCTACGGGTAGCTGGGTGCTGTCCAAAGGCGACAGGGCGTCGTTAGGGGAGC
HKR188545 ARi71G01 pGCAP10 NM_016147.1  
TGAGGGGAGCGAGTCGTGACCGGTTGGGCCACACTCAACGTGGGACGAAGCTTCGCCTAC
HKR209456 ARiS023K16 pGCAP10 NM_016147.1  
GGAGTCGTGACCGGTTGGGCCACACTCAACGTGGGACGAAGCTTCGCCTACTGTTTGACT
HKR234902 ARiS087E06 pGCAP10 NM_016147.1  
TGGCTTCCCCTACTGTTTGACTACGTGCGTGCAGCCTCCCCTCGATGTCGGCCCTCGAAA
HKR277911 ARiS194M23 pGCAP10 NM_016147.1  
GGAGTCGTGACCGGTNGGGCCACACTCAACGTGGGACGAAGCTTCGCCTACTGTTTGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl