Prev. | 

RIKEN DNA Bank Human Resource - WDR83OS

Gene ID NCBI Gene 51398 |  KEGG hsa:51398
Gene Symbol WDR83OS
Protein Name WD repeat domain 83 opposite strand
Synonyms C19orf56|PTD008
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053837 IRAK134J21 pCMV-SPORT6 BC061912 NM_016145 Full
HGY097970 IRAL044P10 pOTB7 BC042919 NM_016145 Full
HGY082773 IRAL006P13 pOTB7 BC001192 NM_016145 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003633 W01A009B09 pENTR-TOPO IRAK134J21 BC061912 NM_016145  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050875 ARe27D03 pKA1U5 NM_016145.3  
GCTTCGACTCGCTATGTCCACTAACAATATGTCGGACCCACGGAGGCCGAACAAAGTGCT
HKR052980 ARe32H12 pKA1U5 NM_016145.3  
GAGAGGCGTGATCTGGCCTTCGACTCGCTATGCTCCACTAACAATATGTCGGACCCACGG
HKR060811 ARe52A11 pKA1U5 NM_016145.3  
GCTTCGACTCGCTATGTTCCACTAACAATATGCTCCGANCCACGGAGGCCGAACAAAGTG
HKR364082 RBd10D10 pGCAP10 NM_016145.3  
GGGAAGAGGCGTGATCTGGCCTTCGACTCGCTATGTCCACTAACAATATGTCGGACCCAC
HKR373330 RBd33F10 pGCAP10 NM_016145.3  
GCTTCGACTCGCTATGTCCACTAACAATATGTCGGACCCACGGAGGCCGAACAAAGTGCT
HKR397724 RBd94F04 pGCAP10 NM_016145.3  
GACTCGCTATGTCCACTAACAATATGTCGGACCCACGGAGGCCGAACAAAGTGCTGAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl