Prev. | 

RIKEN DNA Bank Human Resource - AIG1

Gene ID NCBI Gene 51390 |  KEGG hsa:51390
Gene Symbol AIG1
Protein Name androgen induced 1
Synonyms AIG-1|dJ95L4.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096992 IRAL042H24 pOTB7 BC025278 NM_016108 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085238 M01C013B14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085286 M01C013D14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085334 M01C013F14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085382 M01C013H14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085430 M01C013J14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085478 M01C013L14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085526 M01C013N14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  
HGE085574 M01C013P14 pDONR221 FLJ04-D07 AK001347 ENST00000367596  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173331 ARi33F11 pGCAP10 NM_016108.2  
GGCCCTCCTTGCCGCCCAGCCGGTCCAGGCCTCTGGCGAACATGGCGCTTGTCCCCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl