Prev. | 

RIKEN DNA Bank Human Resource - RWDD1

Gene ID NCBI Gene 51389 |  KEGG hsa:51389
Gene Symbol RWDD1
Protein Name RWD domain containing 1
Synonyms CGI-24|PTD013
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006117 IRAK015E21 pCMV-SPORT6 BC015802 NM_016104 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113213 M01C083A13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113261 M01C083C13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113309 M01C083E13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113357 M01C083G13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113405 M01C083I13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113453 M01C083K13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113501 M01C083M13 pDONR221 IMS05-A07 BC015802 NM_015952  
HGE113549 M01C083O13 pDONR221 IMS05-A07 BC015802 NM_015952  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161698 ARi04E02 pGCAP10 NM_001007464.1  
GGCCTGGCCGCCGCCCGCTCTCCCGGCGCGGCACCTGTCTGGGCTGCTGCGCGCCGCCTA
HKR235513 ARiS088N01 pGCAP10 NM_001007464.1  
TGCTCCCGGCGCGGCACCTTGTCNGGGCNGCNGCGCGCCGCCTAGGTGTCTGGGCNNTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl