Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF589

Gene ID NCBI Gene 51385 |  KEGG hsa:51385
Gene Symbol ZNF589
Protein Name zinc finger protein 589
Synonyms SZF1
Ortholog resource in our bank

  ZNF589

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001320 IRAK003E24 pCMV-SPORT6 BC008213 NM_016089 Partial/var
HGX037557 IRAK093O21 pCMV-SPORT6 BC048798 NM_016089 Partial/var
HGY084491 IRAL011D19 pOTB7 BC005859 NM_016089 Partial/var
HGY086171 IRAL015H03 pOTB7 BC006247 NM_016089 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR344449 RBb61C01 pGCAP1 NM_016089.2  
GGTTTCACACACGGTGCTGCTACCTCGTTTGCTTCGTGCGTGCGTGCGCAGATGTGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl