Prev. |  KEGG KO K05610 > 

RIKEN DNA Bank Human Resource - UCHL5

Gene ID NCBI Gene 51377 |  KEGG hsa:51377
Gene Symbol UCHL5
Protein Name ubiquitin C-terminal hydrolase L5
Synonyms CGI-70|INO80R|UCH-L5|UCH37
Ortholog resources KEGG ortholog (KEGG orthology K05610) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009030 IRAK022J14 pCMV-SPORT6 BC015521 NM_015984 Full/var
HGY090083 IRAL025D11 pOTB7 BC025369 NM_015984 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024997 W01A062I05 pENTR-TOPO flj0057l06 AK024751 NM_015984  
HGE024999 W01A062I07 pENTR-TOPO flj0057l06 AK024751 NM_015984  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172525 ARi31F05 pGCAP10 NM_015984.2  
GGACGTGTGGTTGACGAGCTCGGCGGCGGGTTTGCTGAGATCTGTGGCCGGCGGCAGCTG
HKR176952 ARi42G08 pGCAP10 NM_015984.2  
GGACGTGTGGTTGACGAGCTCGGCGGCGGGTTTGCTGAGATCTGTGGCCGGCGGCAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl